Sequence Alignment Problem Set

1. Align the following two sequences: Sequence A = GGGCUUCCGGCCACA and Sequence B = GCGCUUCCGGGCGCA

2. Now add the following sequence to this alignment: Sequence C = GUGCUUCGGACGC

3. Now add the following sequence to this alignment: Sequence D = GGCUUACGGUCACA

4. Align the following sequences:

Sequence A : GGAGCAGUCCGUGGAUC
Sequence B : UAGGAGCAGCCGUGGAUC
Sequence C : GGAGCAGGCCGUGGUACC

5. Align the following sequences:

Sequence A : CUCGAGUUAACCCGGCACCCG
Sequence B : GCUCGGGUUAACACGGACCCG
Sequence C : UCGAGUUAACUCGGACCCG

6. Align the following sequences (note that these are in Fasta format, commonly used for the electronic transfer of sequence data):

>tRNA-A
GGGCUCAUAGCUCAGCGGUAGAGUGCCUCCUUUGCAAGGAGGAUGCCCUGGGUUCGAAUCCCAGUGAGUCCA
>tRNA-B
GGGCUCAUCGCUCAGCGGUAGAGUGCCUCCCUUGCAAGGAGGAUGCCCUGGGUUCGAAUCCCAGUGAGUCCA
>tRNA-C
GGGCUCGUAGCUCAGCGGGAGAGCGCCGCCUUUGCGAGGCGGAGGCCGCGGGUUCAAAUCCCGCCGAGUCCA
>tRNA-D
GGGCUCGUAGCUCAGCGGGAGAGCGCCGCCUUCGCGAGGCGGAGGCCGCGGGUUCAAAUCCCGCCGAGUCCA
>tRNA-E
GGGCCGGUAGCUCAGUCUGGUAGAGCGUCGCCUUGGCAUGGCGAAGGCCGGGGUUCAAAUCCCCACCGGU

7. Draw the secondary structures of the sequences in this alignment:


      
         A A                  ( ( ( ( - - - - ) ) ) ) - -
       G     A        Seq V   G G G G G A U A C U U C U A
        C - G         Seq W   A U G C U U C G G C A U U A
        U - A         Seq X   G U U U U U U - A A G C U A
        G - C         Seq Y   G G C - C U U G - G C C - A 
        G - C U A     Seq Z   U U U U U U U U A A A A A A 

8. Create an alignment of the following RNA structures:


                                       A C           U U
         U C           U C C         U     G       C     G
       U     G       G       A        G - C         G - C         U
        C - G          G - C          C - G         C - G      U     U 
        U - G          C - G               A        U - A       U - A
        C - G          A - U          A - U         C - G       U - A
        C - G U      A G - C U A    A G - C U A     C - G U     C - G U A


9. Add the following RNA structure to the preexisting alignment:



     U C 
   U     G      U                  ( ( ( ( - - - - ) ) ) ) - - ( ( ( - - - - ) ) ) - - -
    C - G    U     U       Seq W   C U U C G A G A G A A G - G C U C U U C G G A G U A U
    U - G     U - A        Seq X   C C C - U G C - - G G G U G C G C U U C - G C G U A -
    C - G     U - A        Seq Y   U C C - C U U C - G G G - A C U C C U U G G G G U G C
    C - G U A C - G U A    Seq Z   G A A G G A G A U U U U U G G G G U U U A C C C U A G