Tree construction Problem set

1. Construct a similarity matrix from this alignment:

       Seq A   G A U C U U U G G A U C
       Seq B   A A U C U C U G G A U U
       Seq C   C A U C U U U - G A U G
       Seq D   A A U C U U U G G A U U
       Seq E   C A U C U C U G A A U G

2. Given the Jukes & Cantor conversion graph, convert the similarity matrix from question 1 to a distance matrix.

3. Given this distance matrix, draw a tree relating these sequences and label the lengths of the branches of the tree:

               Seq A   Seq B  Seq C  Seq D
       Seq A     -      -      -      -
       Seq B    0.2     -      -      -
       Seq C    0.6    0.6     -      -
       Seq D    0.9    0.9    0.9     -

4. Given this distance matrix, draw the structure of a tree relating the sequences using the neighbor-joining method, and label the lengths of the branches:

               Seq A   Seq B   Seq C   Seq D   Seq E   Seq F
       Seq A     -       -       -       -       -       -
       Seq B    0.2      -       -       -       -       -
       Seq C    0.7     0.7      -       -       -       -
       Seq D    0.6     0.6     0.5      -       -       -
       Seq E    0.7     0.7     0.8     0.7      -       -
       Seq F    0.6     0.6     0.7     0.6     0.3      -

5. Generate a tree from this alignment using the neighbor-joining method, with approximate branch lengths, from these X RNA sequences.

       Thiobacillus ferrooxidans  GAAUUCCCGGGAG-GGGCCAGGCGACCCCCGAAUUCCCGG
       Escherichia coli           GAAUUCCCGGAAGCAGACCAGACAGUCGCCGAAUUCCCGG
       Serratia marcescens        GAAUUCCCGGAAGUAGACCAGACAGUCACCGAAUUCCCGG
       Chromatium vinosum         GAAUUCCCGGGAG-GGGCCAGACAGUCCCUGAAUUCCCG-