Phylogenetic Analysis


Cautions
Caution!

Gel electrophoresis involves dangerous electric currents. Always turn the power supply off AND disconnect the leads from the gel before approaching the electrophoresis chamber.

After electrophoresis, the TA will remove the gel and soak it in ethidium bromide stain before photography. Only the TA should handle ethidium bromide or anything that contacts it. ETHIDIUM BROMIDE IS A CARCINOGEN.


Introduction

Most Microbiology labs involve an "unknown". Rather than identify some boring standard domesticated teaching lab bacterium from a pure culture or simple mixture, in this experiment takes something you've isolated in the other experiments, probably several somethings, who knows what, from environmental samples you bring in, and then identify them phylogenetically from the sequence of their small subunit ribosomal RNAs.

The experiment has two components:

  1. Some molecular biology that results in ssu-rRNA sequences from these organisms, and
  2. The molecular phylogenetic analysis of these sequence (this is the Term Project).

ssu-rRNA PCR amplification

Be careful at all times to avoid contamination

  • Always use filter sterilized distilled water
  • Autoclave all tips and tubes and wear gloves
  • Use clean, untouched disposable plasticware

Materials

ssu-rRNA primers

                                   XbaI
     515FPL (515-533)     5' GCGGATCCTCTAGACTGCAGTGCCAGCAGCCGCGGTAA 3' 
                               BamHI       PstI
     
                                   NotI
    1492RPL (1510-1492)  5' GGCTCGAGCGGCCGCCCGGGTTACCTTGTTACGACTT 3'
                               XhoI        XmaI
      


stocks: 1 mg/ml in water
dilute 1:10 for a working solution of 100 ug/ml

PCR master Mix kits (Promega Corp. catalog # M7502) - included sterile ddH2O. Premix 1:1 for students.


Procedure

  1. Touch one of your unknown colonies with a sterile loop, then swirl the loop in 50ul of PCR premix in an 0.5ml microfuge tube. Repeat this with your other unknowns in separate PCR premix tubes.
  2. Add 3 drops of mineral oil to each of these tubes to cover the liquid, and keep on ice until ready to load into thermocycler.
  3. Run PCR program 71:
  • File 71 = 94C 2 min (hot start), link to file 72
  • File 72 = 92C 1.5 min (template denaturation), 50C 1.5 min (primer annealing), 72C 0.5 min (primer extension), repeated 30 times, then link to file 73
  • File 73 = 72C 7 min (additional extension time), link to file 74
  • File 74 = 4C indefinitely (cold storage)

Preparation of PCR products for sequencing

Materials

  • NucleoSpin II extraction kits (ClonTech)
  • 1.5ml microfuge tubes & microfuge
  • PCR reactions from the previous experiments

Procedure

This procedure is described in detail in the protocol and booklet supplied in the kit:

  1. Collect the PCR reaction (leave the mineral oil behind) with a pipet gun, wipe off excess oil from the tip, and transfer to a clean 1.5ml microfuge tube. If there is any oil carried over into the new tube, draw it out with a pipet tip & discard.
  2. Add 100ul of buffer NT to the sample and mix by vortexing.
  3. Insert a NucleoSpin column into the collection tube. Pipet the sample into the column, and centrifuge for 1 min. Discard the flow-through liquid.
  4. Put the column back into the collection tube, and add 600ul NT3. Centrifuge for 1 min., and discard the flow-through liquid.
  5. Put the column back into the collection tube, and centrifuge for 2 min. to remove any residual buffer.
  6. Transfer the NucleoSpin column to a clean 1.5ml centrifuge tube (discard the collection tube).
  7. Add 50ul buffer NE. Incubate at room temperature for 1 min, and then centrifuge 1 min. Discard the column, and label the centrifuge tube with your culture number and initials.

Agarose gel electrophoresis of PCR products

Materials

  • 1% agaorose gel in TAE
  • 10X TBJ (loading buffer w/ dye)
  • 1ug/ml ethidium bromide in a tupperware tub
  • parafilm
  • P20 pipet tips
  • agarose mingel units w/ combs & leads
  • microwave oven
  • kimwipes
  • photodocumentation system
  • PCR reactions from the previous lab
  • power supply

Procedure

  1. Spot 1ul of 10X TBJ onto a small piece of parafilm.
  2. Draw 5ul from the PCR reaction through the mineral oil layer. Wipe the pipet tip off with a Kimwipe, then transfer onto one of the TBJ spots on the parafilm.
  3. Mix the sample and loading dye by repeated pipetting.
  4. Load the sample into a well of the gel. The samples should be loaded in sequence according to a list so that the order of sample is known. The TA will load a negative control reation and a sample of 1Kb molecular weight ladder.
  5. Electrophorese at 100 volts for 1 hour. The bromophenol blue dye should migrate to between half and 3/4's of the length of the gel (the xylene cyanol will migrate 1/2 as far).
  6. Soak the gel in ethidium bromide for 30 minutes to stain the DNA. Examine the gel on the transilluminator, capture and print the image.

The gels should look something like this:

gel


The Term Project

The TA will measure the A260 of all of the purified PCR products estimate their concentration, and they will be diluted appropriately and sent to the DNA Sequencing Facility for sequencing with primer 515Fshort (a modified version of the 515FPL primer used in the PCR reaction - GATCCTCTAGACTGCAGTG. The sequence that comes back is the starting point for your term project.